ID: 1173111669

View in Genome Browser
Species Human (GRCh38)
Location 20:40196757-40196779
Sequence CTAGTTGGAAGCAGCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173111663_1173111669 18 Left 1173111663 20:40196716-40196738 CCATGTACACATTTGCGTGTACC No data
Right 1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG No data
1173111667_1173111669 -7 Left 1173111667 20:40196741-40196763 CCTTGGTAGGTATCATCTAGTTG No data
Right 1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG No data
1173111666_1173111669 -3 Left 1173111666 20:40196737-40196759 CCAGCCTTGGTAGGTATCATCTA No data
Right 1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173111669 Original CRISPR CTAGTTGGAAGCAGCTCAGC AGG Intergenic
No off target data available for this crispr