ID: 1173113887

View in Genome Browser
Species Human (GRCh38)
Location 20:40222012-40222034
Sequence CAGAGTTACTCATAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173113887_1173113890 -7 Left 1173113887 20:40222012-40222034 CCAACTTCCTATGAGTAACTCTG No data
Right 1173113890 20:40222028-40222050 AACTCTGTAACATCTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173113887 Original CRISPR CAGAGTTACTCATAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr