ID: 1173113890

View in Genome Browser
Species Human (GRCh38)
Location 20:40222028-40222050
Sequence AACTCTGTAACATCTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173113886_1173113890 -6 Left 1173113886 20:40222011-40222033 CCCAACTTCCTATGAGTAACTCT No data
Right 1173113890 20:40222028-40222050 AACTCTGTAACATCTGGACATGG No data
1173113887_1173113890 -7 Left 1173113887 20:40222012-40222034 CCAACTTCCTATGAGTAACTCTG No data
Right 1173113890 20:40222028-40222050 AACTCTGTAACATCTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173113890 Original CRISPR AACTCTGTAACATCTGGACA TGG Intergenic
No off target data available for this crispr