ID: 1173114321

View in Genome Browser
Species Human (GRCh38)
Location 20:40225587-40225609
Sequence GCCAAAACTGTCTCCACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173114321_1173114323 -5 Left 1173114321 20:40225587-40225609 CCATGTGTGGAGACAGTTTTGGC No data
Right 1173114323 20:40225605-40225627 TTGGCTACCATAACTGGAGATGG No data
1173114321_1173114326 19 Left 1173114321 20:40225587-40225609 CCATGTGTGGAGACAGTTTTGGC No data
Right 1173114326 20:40225629-40225651 GGCATACTAATAGCATCTAGTGG No data
1173114321_1173114324 -2 Left 1173114321 20:40225587-40225609 CCATGTGTGGAGACAGTTTTGGC No data
Right 1173114324 20:40225608-40225630 GCTACCATAACTGGAGATGGAGG No data
1173114321_1173114327 20 Left 1173114321 20:40225587-40225609 CCATGTGTGGAGACAGTTTTGGC No data
Right 1173114327 20:40225630-40225652 GCATACTAATAGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173114321 Original CRISPR GCCAAAACTGTCTCCACACA TGG (reversed) Intergenic
No off target data available for this crispr