ID: 1173114555

View in Genome Browser
Species Human (GRCh38)
Location 20:40228381-40228403
Sequence CTGCCCATGGAGAAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173114555_1173114560 10 Left 1173114555 20:40228381-40228403 CCCTCAGTCTTCTCCATGGGCAG No data
Right 1173114560 20:40228414-40228436 CTTCCAGCTCTTCTCTGCTTTGG No data
1173114555_1173114563 26 Left 1173114555 20:40228381-40228403 CCCTCAGTCTTCTCCATGGGCAG No data
Right 1173114563 20:40228430-40228452 GCTTTGGTGGCTTGTGCTTCTGG No data
1173114555_1173114562 13 Left 1173114555 20:40228381-40228403 CCCTCAGTCTTCTCCATGGGCAG No data
Right 1173114562 20:40228417-40228439 CCAGCTCTTCTCTGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173114555 Original CRISPR CTGCCCATGGAGAAGACTGA GGG (reversed) Intergenic
No off target data available for this crispr