ID: 1173118382

View in Genome Browser
Species Human (GRCh38)
Location 20:40268129-40268151
Sequence TTGGCACCCTTGCCTCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173118382_1173118385 2 Left 1173118382 20:40268129-40268151 CCACCTTGAGGCAAGGGTGCCAA No data
Right 1173118385 20:40268154-40268176 TTTTCTGCCCTTGTGTTAGTTGG No data
1173118382_1173118390 27 Left 1173118382 20:40268129-40268151 CCACCTTGAGGCAAGGGTGCCAA No data
Right 1173118390 20:40268179-40268201 ATTGGCTACTGACAGACTTCTGG No data
1173118382_1173118387 9 Left 1173118382 20:40268129-40268151 CCACCTTGAGGCAAGGGTGCCAA No data
Right 1173118387 20:40268161-40268183 CCCTTGTGTTAGTTGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173118382 Original CRISPR TTGGCACCCTTGCCTCAAGG TGG (reversed) Intergenic