ID: 1173121223

View in Genome Browser
Species Human (GRCh38)
Location 20:40291306-40291328
Sequence GTGGCTATATCTAGACTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173121220_1173121223 18 Left 1173121220 20:40291265-40291287 CCAAATGACTGATCGTGGCTGCT No data
Right 1173121223 20:40291306-40291328 GTGGCTATATCTAGACTCAATGG No data
1173121218_1173121223 20 Left 1173121218 20:40291263-40291285 CCCCAAATGACTGATCGTGGCTG No data
Right 1173121223 20:40291306-40291328 GTGGCTATATCTAGACTCAATGG No data
1173121219_1173121223 19 Left 1173121219 20:40291264-40291286 CCCAAATGACTGATCGTGGCTGC No data
Right 1173121223 20:40291306-40291328 GTGGCTATATCTAGACTCAATGG No data
1173121216_1173121223 24 Left 1173121216 20:40291259-40291281 CCTACCCCAAATGACTGATCGTG No data
Right 1173121223 20:40291306-40291328 GTGGCTATATCTAGACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173121223 Original CRISPR GTGGCTATATCTAGACTCAA TGG Intergenic