ID: 1173121223 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:40291306-40291328 |
| Sequence | GTGGCTATATCTAGACTCAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1173121220_1173121223 | 18 | Left | 1173121220 | 20:40291265-40291287 | CCAAATGACTGATCGTGGCTGCT | No data | ||
| Right | 1173121223 | 20:40291306-40291328 | GTGGCTATATCTAGACTCAATGG | No data | ||||
| 1173121218_1173121223 | 20 | Left | 1173121218 | 20:40291263-40291285 | CCCCAAATGACTGATCGTGGCTG | No data | ||
| Right | 1173121223 | 20:40291306-40291328 | GTGGCTATATCTAGACTCAATGG | No data | ||||
| 1173121219_1173121223 | 19 | Left | 1173121219 | 20:40291264-40291286 | CCCAAATGACTGATCGTGGCTGC | No data | ||
| Right | 1173121223 | 20:40291306-40291328 | GTGGCTATATCTAGACTCAATGG | No data | ||||
| 1173121216_1173121223 | 24 | Left | 1173121216 | 20:40291259-40291281 | CCTACCCCAAATGACTGATCGTG | No data | ||
| Right | 1173121223 | 20:40291306-40291328 | GTGGCTATATCTAGACTCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1173121223 | Original CRISPR | GTGGCTATATCTAGACTCAA TGG | Intergenic | ||