ID: 1173125063

View in Genome Browser
Species Human (GRCh38)
Location 20:40328943-40328965
Sequence GAAAATCATGGGTGGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173125063_1173125074 10 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125074 20:40328976-40328998 TGGGGAGGAAGGAGTAAAAAAGG No data
1173125063_1173125070 -9 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125070 20:40328957-40328979 ATGATTTTCTGAATCAGAATGGG No data
1173125063_1173125073 -1 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG No data
1173125063_1173125071 -8 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125071 20:40328958-40328980 TGATTTTCTGAATCAGAATGGGG No data
1173125063_1173125069 -10 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125069 20:40328956-40328978 CATGATTTTCTGAATCAGAATGG No data
1173125063_1173125072 -5 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125072 20:40328961-40328983 TTTTCTGAATCAGAATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173125063 Original CRISPR GAAAATCATGGGTGGGGCAT TGG (reversed) Intergenic
No off target data available for this crispr