ID: 1173125066

View in Genome Browser
Species Human (GRCh38)
Location 20:40328951-40328973
Sequence CTGATTCAGAAAATCATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173125066_1173125074 2 Left 1173125066 20:40328951-40328973 CCACCCATGATTTTCTGAATCAG No data
Right 1173125074 20:40328976-40328998 TGGGGAGGAAGGAGTAAAAAAGG No data
1173125066_1173125073 -9 Left 1173125066 20:40328951-40328973 CCACCCATGATTTTCTGAATCAG No data
Right 1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173125066 Original CRISPR CTGATTCAGAAAATCATGGG TGG (reversed) Intergenic
No off target data available for this crispr