ID: 1173125073

View in Genome Browser
Species Human (GRCh38)
Location 20:40328965-40328987
Sequence CTGAATCAGAATGGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173125065_1173125073 -8 Left 1173125065 20:40328950-40328972 CCCACCCATGATTTTCTGAATCA No data
Right 1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG No data
1173125064_1173125073 -7 Left 1173125064 20:40328949-40328971 CCCCACCCATGATTTTCTGAATC No data
Right 1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG No data
1173125066_1173125073 -9 Left 1173125066 20:40328951-40328973 CCACCCATGATTTTCTGAATCAG No data
Right 1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG No data
1173125063_1173125073 -1 Left 1173125063 20:40328943-40328965 CCAATGCCCCACCCATGATTTTC No data
Right 1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173125073 Original CRISPR CTGAATCAGAATGGGGAGGA AGG Intergenic
No off target data available for this crispr