ID: 1173125800

View in Genome Browser
Species Human (GRCh38)
Location 20:40335005-40335027
Sequence CCTGTTAAGTACACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173125800_1173125804 25 Left 1173125800 20:40335005-40335027 CCCTCCTCTGTGTACTTAACAGG No data
Right 1173125804 20:40335053-40335075 TCCCAACTTCCTCTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173125800 Original CRISPR CCTGTTAAGTACACAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr