ID: 1173125872

View in Genome Browser
Species Human (GRCh38)
Location 20:40335562-40335584
Sequence CTGTAAATTTAAGTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173125872_1173125877 30 Left 1173125872 20:40335562-40335584 CCATTCTCCACTTAAATTTACAG No data
Right 1173125877 20:40335615-40335637 CAGAAAATGACCCTCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173125872 Original CRISPR CTGTAAATTTAAGTGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr