ID: 1173126842

View in Genome Browser
Species Human (GRCh38)
Location 20:40345151-40345173
Sequence CTTGAAGCCAACACAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173126842_1173126848 15 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126848 20:40345189-40345211 CCCCCGTTGTGGTGGCTACAGGG No data
1173126842_1173126853 21 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126853 20:40345195-40345217 TTGTGGTGGCTACAGGGGCATGG No data
1173126842_1173126846 14 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126846 20:40345188-40345210 GCCCCCGTTGTGGTGGCTACAGG No data
1173126842_1173126845 7 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126845 20:40345181-40345203 TAACACAGCCCCCGTTGTGGTGG No data
1173126842_1173126850 16 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126850 20:40345190-40345212 CCCCGTTGTGGTGGCTACAGGGG No data
1173126842_1173126854 22 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126854 20:40345196-40345218 TGTGGTGGCTACAGGGGCATGGG No data
1173126842_1173126843 4 Left 1173126842 20:40345151-40345173 CCTGGTGCTGTGTTGGCTTCAAG No data
Right 1173126843 20:40345178-40345200 ACCTAACACAGCCCCCGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173126842 Original CRISPR CTTGAAGCCAACACAGCACC AGG (reversed) Intergenic
No off target data available for this crispr