ID: 1173134239

View in Genome Browser
Species Human (GRCh38)
Location 20:40425144-40425166
Sequence AGAATCCATGAGGATAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173134233_1173134239 6 Left 1173134233 20:40425115-40425137 CCAAGCAATGCCAAAGGCCCATA No data
Right 1173134239 20:40425144-40425166 AGAATCCATGAGGATAGACATGG No data
1173134230_1173134239 20 Left 1173134230 20:40425101-40425123 CCATCTCCTGTGGTCCAAGCAAT No data
Right 1173134239 20:40425144-40425166 AGAATCCATGAGGATAGACATGG No data
1173134231_1173134239 14 Left 1173134231 20:40425107-40425129 CCTGTGGTCCAAGCAATGCCAAA No data
Right 1173134239 20:40425144-40425166 AGAATCCATGAGGATAGACATGG No data
1173134235_1173134239 -4 Left 1173134235 20:40425125-40425147 CCAAAGGCCCATATGGATCAGAA No data
Right 1173134239 20:40425144-40425166 AGAATCCATGAGGATAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173134239 Original CRISPR AGAATCCATGAGGATAGACA TGG Intergenic
No off target data available for this crispr