ID: 1173139445

View in Genome Browser
Species Human (GRCh38)
Location 20:40469573-40469595
Sequence AGAAGGTGTCTGGTCAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173139445_1173139448 0 Left 1173139445 20:40469573-40469595 CCTAGGTTGACCAGACACCTTCT No data
Right 1173139448 20:40469596-40469618 GAGACTGCTGTGAGATTTCCTGG No data
1173139445_1173139450 5 Left 1173139445 20:40469573-40469595 CCTAGGTTGACCAGACACCTTCT No data
Right 1173139450 20:40469601-40469623 TGCTGTGAGATTTCCTGGCAGGG No data
1173139445_1173139449 4 Left 1173139445 20:40469573-40469595 CCTAGGTTGACCAGACACCTTCT No data
Right 1173139449 20:40469600-40469622 CTGCTGTGAGATTTCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173139445 Original CRISPR AGAAGGTGTCTGGTCAACCT AGG (reversed) Intergenic
No off target data available for this crispr