ID: 1173139947

View in Genome Browser
Species Human (GRCh38)
Location 20:40473083-40473105
Sequence GGCCTAATTCTGTCCTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173139947_1173139949 5 Left 1173139947 20:40473083-40473105 CCTCTGCAGGACAGAATTAGGCC No data
Right 1173139949 20:40473111-40473133 CATCCATCTTATTCATTCCTAGG No data
1173139947_1173139950 6 Left 1173139947 20:40473083-40473105 CCTCTGCAGGACAGAATTAGGCC No data
Right 1173139950 20:40473112-40473134 ATCCATCTTATTCATTCCTAGGG No data
1173139947_1173139952 19 Left 1173139947 20:40473083-40473105 CCTCTGCAGGACAGAATTAGGCC No data
Right 1173139952 20:40473125-40473147 ATTCCTAGGGCCTTAGTGTTTGG No data
1173139947_1173139954 24 Left 1173139947 20:40473083-40473105 CCTCTGCAGGACAGAATTAGGCC No data
Right 1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173139947 Original CRISPR GGCCTAATTCTGTCCTGCAG AGG (reversed) Intergenic