ID: 1173139948 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:40473104-40473126 |
| Sequence | ATGAATAAGATGGATGAGTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1173139948_1173139954 | 3 | Left | 1173139948 | 20:40473104-40473126 | CCTTACTCATCCATCTTATTCAT | No data | ||
| Right | 1173139954 | 20:40473130-40473152 | TAGGGCCTTAGTGTTTGGACAGG | No data | ||||
| 1173139948_1173139952 | -2 | Left | 1173139948 | 20:40473104-40473126 | CCTTACTCATCCATCTTATTCAT | No data | ||
| Right | 1173139952 | 20:40473125-40473147 | ATTCCTAGGGCCTTAGTGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1173139948 | Original CRISPR | ATGAATAAGATGGATGAGTA AGG (reversed) | Intergenic | ||