ID: 1173139948

View in Genome Browser
Species Human (GRCh38)
Location 20:40473104-40473126
Sequence ATGAATAAGATGGATGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173139948_1173139954 3 Left 1173139948 20:40473104-40473126 CCTTACTCATCCATCTTATTCAT No data
Right 1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG No data
1173139948_1173139952 -2 Left 1173139948 20:40473104-40473126 CCTTACTCATCCATCTTATTCAT No data
Right 1173139952 20:40473125-40473147 ATTCCTAGGGCCTTAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173139948 Original CRISPR ATGAATAAGATGGATGAGTA AGG (reversed) Intergenic