ID: 1173139951

View in Genome Browser
Species Human (GRCh38)
Location 20:40473114-40473136
Sequence GGCCCTAGGAATGAATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173139951_1173139954 -7 Left 1173139951 20:40473114-40473136 CCATCTTATTCATTCCTAGGGCC No data
Right 1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173139951 Original CRISPR GGCCCTAGGAATGAATAAGA TGG (reversed) Intergenic