ID: 1173139954

View in Genome Browser
Species Human (GRCh38)
Location 20:40473130-40473152
Sequence TAGGGCCTTAGTGTTTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173139948_1173139954 3 Left 1173139948 20:40473104-40473126 CCTTACTCATCCATCTTATTCAT No data
Right 1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG No data
1173139947_1173139954 24 Left 1173139947 20:40473083-40473105 CCTCTGCAGGACAGAATTAGGCC No data
Right 1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG No data
1173139951_1173139954 -7 Left 1173139951 20:40473114-40473136 CCATCTTATTCATTCCTAGGGCC No data
Right 1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173139954 Original CRISPR TAGGGCCTTAGTGTTTGGAC AGG Intergenic