ID: 1173144793

View in Genome Browser
Species Human (GRCh38)
Location 20:40515250-40515272
Sequence CACCTGCTTTTCCCTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173144790_1173144793 -5 Left 1173144790 20:40515232-40515254 CCTGCCTCATGGCCTTTGCACCT No data
Right 1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG No data
1173144789_1173144793 -4 Left 1173144789 20:40515231-40515253 CCCTGCCTCATGGCCTTTGCACC No data
Right 1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG No data
1173144787_1173144793 8 Left 1173144787 20:40515219-40515241 CCAAGTTCTCTTCCCTGCCTCAT No data
Right 1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG No data
1173144791_1173144793 -9 Left 1173144791 20:40515236-40515258 CCTCATGGCCTTTGCACCTGCTT No data
Right 1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173144793 Original CRISPR CACCTGCTTTTCCCTGCACC TGG Intergenic
No off target data available for this crispr