ID: 1173147159

View in Genome Browser
Species Human (GRCh38)
Location 20:40534758-40534780
Sequence ACTGCTCCTGTGCTTGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173147159_1173147161 7 Left 1173147159 20:40534758-40534780 CCTCAGCCAAGCACAGGAGCAGT No data
Right 1173147161 20:40534788-40534810 GTTTACGATGTGCTGCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173147159 Original CRISPR ACTGCTCCTGTGCTTGGCTG AGG (reversed) Intergenic
No off target data available for this crispr