ID: 1173148565

View in Genome Browser
Species Human (GRCh38)
Location 20:40546422-40546444
Sequence CTCTGTGAGTACAAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173148560_1173148565 -4 Left 1173148560 20:40546403-40546425 CCATAAAACCCAAGGTCTTCTCT No data
Right 1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173148565 Original CRISPR CTCTGTGAGTACAAGGATGA GGG Intergenic
No off target data available for this crispr