ID: 1173150405

View in Genome Browser
Species Human (GRCh38)
Location 20:40562155-40562177
Sequence GACCCCACCCCCAGAGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173150405_1173150411 17 Left 1173150405 20:40562155-40562177 CCTCACTCTCTGGGGGTGGGGTC No data
Right 1173150411 20:40562195-40562217 TGACTCACTGCCCAAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173150405 Original CRISPR GACCCCACCCCCAGAGAGTG AGG (reversed) Intergenic
No off target data available for this crispr