ID: 1173150834

View in Genome Browser
Species Human (GRCh38)
Location 20:40565425-40565447
Sequence GTGCAGGGGAATGCAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173150827_1173150834 3 Left 1173150827 20:40565399-40565421 CCAATTTGGGTCCCGAAGGATAG No data
Right 1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG No data
1173150829_1173150834 -8 Left 1173150829 20:40565410-40565432 CCCGAAGGATAGCCTGTGCAGGG No data
Right 1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG No data
1173150831_1173150834 -9 Left 1173150831 20:40565411-40565433 CCGAAGGATAGCCTGTGCAGGGG No data
Right 1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG No data
1173150825_1173150834 8 Left 1173150825 20:40565394-40565416 CCTTGCCAATTTGGGTCCCGAAG No data
Right 1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173150834 Original CRISPR GTGCAGGGGAATGCAAAGTG AGG Intergenic
No off target data available for this crispr