ID: 1173152203

View in Genome Browser
Species Human (GRCh38)
Location 20:40577179-40577201
Sequence CAAGGGTGTTTCCAGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173152191_1173152203 21 Left 1173152191 20:40577135-40577157 CCAGTAGCTCCCTGGGTACTTGT No data
Right 1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG No data
1173152195_1173152203 11 Left 1173152195 20:40577145-40577167 CCTGGGTACTTGTGGGACAGTAT No data
Right 1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG No data
1173152194_1173152203 12 Left 1173152194 20:40577144-40577166 CCCTGGGTACTTGTGGGACAGTA No data
Right 1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173152203 Original CRISPR CAAGGGTGTTTCCAGTGGAT GGG Intergenic
No off target data available for this crispr