ID: 1173154909

View in Genome Browser
Species Human (GRCh38)
Location 20:40600654-40600676
Sequence TAGGAACCTTAGCCCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173154909_1173154913 4 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154913 20:40600681-40600703 ACTTCCTGTACATGTCAGGGTGG No data
1173154909_1173154920 22 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154920 20:40600699-40600721 GGTGGGTCAAGGATTGGGCAGGG No data
1173154909_1173154919 21 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154919 20:40600698-40600720 GGGTGGGTCAAGGATTGGGCAGG No data
1173154909_1173154914 5 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154914 20:40600682-40600704 CTTCCTGTACATGTCAGGGTGGG No data
1173154909_1173154918 17 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154918 20:40600694-40600716 GTCAGGGTGGGTCAAGGATTGGG No data
1173154909_1173154912 1 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154912 20:40600678-40600700 CGCACTTCCTGTACATGTCAGGG No data
1173154909_1173154922 27 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154922 20:40600704-40600726 GTCAAGGATTGGGCAGGGCTGGG No data
1173154909_1173154916 11 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154916 20:40600688-40600710 GTACATGTCAGGGTGGGTCAAGG No data
1173154909_1173154923 30 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154923 20:40600707-40600729 AAGGATTGGGCAGGGCTGGGTGG No data
1173154909_1173154921 26 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154921 20:40600703-40600725 GGTCAAGGATTGGGCAGGGCTGG No data
1173154909_1173154911 0 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154911 20:40600677-40600699 ACGCACTTCCTGTACATGTCAGG No data
1173154909_1173154917 16 Left 1173154909 20:40600654-40600676 CCAGGGTGGGGCTAAGGTTCCTA No data
Right 1173154917 20:40600693-40600715 TGTCAGGGTGGGTCAAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173154909 Original CRISPR TAGGAACCTTAGCCCCACCC TGG (reversed) Intergenic