ID: 1173155405

View in Genome Browser
Species Human (GRCh38)
Location 20:40604453-40604475
Sequence GTGAGCAATAATAATCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173155399_1173155405 19 Left 1173155399 20:40604411-40604433 CCCTCTTCAGCCATGAGTGTAAA No data
Right 1173155405 20:40604453-40604475 GTGAGCAATAATAATCCTACTGG No data
1173155398_1173155405 20 Left 1173155398 20:40604410-40604432 CCCCTCTTCAGCCATGAGTGTAA No data
Right 1173155405 20:40604453-40604475 GTGAGCAATAATAATCCTACTGG No data
1173155404_1173155405 9 Left 1173155404 20:40604421-40604443 CCATGAGTGTAAAAGGGGCTCAA No data
Right 1173155405 20:40604453-40604475 GTGAGCAATAATAATCCTACTGG No data
1173155400_1173155405 18 Left 1173155400 20:40604412-40604434 CCTCTTCAGCCATGAGTGTAAAA No data
Right 1173155405 20:40604453-40604475 GTGAGCAATAATAATCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173155405 Original CRISPR GTGAGCAATAATAATCCTAC TGG Intergenic
No off target data available for this crispr