ID: 1173155562

View in Genome Browser
Species Human (GRCh38)
Location 20:40605730-40605752
Sequence CTGGTTATGCACTGTGGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173155556_1173155562 -7 Left 1173155556 20:40605714-40605736 CCTCTCTTGAGAGCCCCTGGTTA No data
Right 1173155562 20:40605730-40605752 CTGGTTATGCACTGTGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173155562 Original CRISPR CTGGTTATGCACTGTGGGTC CGG Intergenic
No off target data available for this crispr