ID: 1173158329

View in Genome Browser
Species Human (GRCh38)
Location 20:40633659-40633681
Sequence GCTCTTGGGCACAGGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173158329_1173158335 -6 Left 1173158329 20:40633659-40633681 CCAAGGCCCCTGTGCCCAAGAGC No data
Right 1173158335 20:40633676-40633698 AAGAGCCCCCTGAACCTGCTCGG No data
1173158329_1173158336 -3 Left 1173158329 20:40633659-40633681 CCAAGGCCCCTGTGCCCAAGAGC No data
Right 1173158336 20:40633679-40633701 AGCCCCCTGAACCTGCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173158329 Original CRISPR GCTCTTGGGCACAGGGGCCT TGG (reversed) Intergenic