ID: 1173161335

View in Genome Browser
Species Human (GRCh38)
Location 20:40654690-40654712
Sequence CATTGAAGGCAGGCCCGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173161335_1173161340 19 Left 1173161335 20:40654690-40654712 CCACTACGGGCCTGCCTTCAATG No data
Right 1173161340 20:40654732-40654754 CTTTGAACACCTCTAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173161335 Original CRISPR CATTGAAGGCAGGCCCGTAG TGG (reversed) Intergenic
No off target data available for this crispr