ID: 1173162528

View in Genome Browser
Species Human (GRCh38)
Location 20:40663386-40663408
Sequence GTGGAGGATCTCCAGTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173162517_1173162528 1 Left 1173162517 20:40663362-40663384 CCCCAGCCTGGAACACCCTTCCC No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162519_1173162528 -1 Left 1173162519 20:40663364-40663386 CCAGCCTGGAACACCCTTCCCAG No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162515_1173162528 19 Left 1173162515 20:40663344-40663366 CCTTTGTGCATTCAGTTTCCCCA No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162513_1173162528 28 Left 1173162513 20:40663335-40663357 CCTCCTGTGCCTTTGTGCATTCA No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162512_1173162528 29 Left 1173162512 20:40663334-40663356 CCCTCCTGTGCCTTTGTGCATTC No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162514_1173162528 25 Left 1173162514 20:40663338-40663360 CCTGTGCCTTTGTGCATTCAGTT No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162521_1173162528 -5 Left 1173162521 20:40663368-40663390 CCTGGAACACCCTTCCCAGTGGA No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data
1173162518_1173162528 0 Left 1173162518 20:40663363-40663385 CCCAGCCTGGAACACCCTTCCCA No data
Right 1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173162528 Original CRISPR GTGGAGGATCTCCAGTGGAT TGG Intergenic
No off target data available for this crispr