ID: 1173162577

View in Genome Browser
Species Human (GRCh38)
Location 20:40663659-40663681
Sequence AGCTGAAAGATGAACGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173162577_1173162586 25 Left 1173162577 20:40663659-40663681 CCACATTCGTTCATCTTTCAGCT No data
Right 1173162586 20:40663707-40663729 TTCTGTGAGTCCCTCGACCAGGG No data
1173162577_1173162585 24 Left 1173162577 20:40663659-40663681 CCACATTCGTTCATCTTTCAGCT No data
Right 1173162585 20:40663706-40663728 CTTCTGTGAGTCCCTCGACCAGG No data
1173162577_1173162587 28 Left 1173162577 20:40663659-40663681 CCACATTCGTTCATCTTTCAGCT No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173162577 Original CRISPR AGCTGAAAGATGAACGAATG TGG (reversed) Intergenic
No off target data available for this crispr