ID: 1173162578

View in Genome Browser
Species Human (GRCh38)
Location 20:40663689-40663711
Sequence CAGAAGGCATCTCAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173162578_1173162587 -2 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162578_1173162590 9 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162590 20:40663721-40663743 CGACCAGGGAGGCTGAGCGCTGG No data
1173162578_1173162592 16 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162592 20:40663728-40663750 GGAGGCTGAGCGCTGGCCCCTGG No data
1173162578_1173162585 -6 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162585 20:40663706-40663728 CTTCTGTGAGTCCCTCGACCAGG No data
1173162578_1173162593 17 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162593 20:40663729-40663751 GAGGCTGAGCGCTGGCCCCTGGG No data
1173162578_1173162586 -5 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162586 20:40663707-40663729 TTCTGTGAGTCCCTCGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173162578 Original CRISPR CAGAAGGCATCTCAGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr