ID: 1173162580

View in Genome Browser
Species Human (GRCh38)
Location 20:40663691-40663713
Sequence CACAGAAGGCATCTCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173162580_1173162592 14 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162592 20:40663728-40663750 GGAGGCTGAGCGCTGGCCCCTGG No data
1173162580_1173162586 -7 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162586 20:40663707-40663729 TTCTGTGAGTCCCTCGACCAGGG No data
1173162580_1173162587 -4 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162580_1173162590 7 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162590 20:40663721-40663743 CGACCAGGGAGGCTGAGCGCTGG No data
1173162580_1173162585 -8 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162585 20:40663706-40663728 CTTCTGTGAGTCCCTCGACCAGG No data
1173162580_1173162593 15 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162593 20:40663729-40663751 GAGGCTGAGCGCTGGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173162580 Original CRISPR CACAGAAGGCATCTCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr