ID: 1173162582

View in Genome Browser
Species Human (GRCh38)
Location 20:40663695-40663717
Sequence GACTCACAGAAGGCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173162582_1173162593 11 Left 1173162582 20:40663695-40663717 CCCTGAGATGCCTTCTGTGAGTC No data
Right 1173162593 20:40663729-40663751 GAGGCTGAGCGCTGGCCCCTGGG No data
1173162582_1173162592 10 Left 1173162582 20:40663695-40663717 CCCTGAGATGCCTTCTGTGAGTC No data
Right 1173162592 20:40663728-40663750 GGAGGCTGAGCGCTGGCCCCTGG No data
1173162582_1173162590 3 Left 1173162582 20:40663695-40663717 CCCTGAGATGCCTTCTGTGAGTC No data
Right 1173162590 20:40663721-40663743 CGACCAGGGAGGCTGAGCGCTGG No data
1173162582_1173162587 -8 Left 1173162582 20:40663695-40663717 CCCTGAGATGCCTTCTGTGAGTC No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162582_1173162597 30 Left 1173162582 20:40663695-40663717 CCCTGAGATGCCTTCTGTGAGTC No data
Right 1173162597 20:40663748-40663770 TGGGCTGTGAGCCCCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173162582 Original CRISPR GACTCACAGAAGGCATCTCA GGG (reversed) Intergenic
No off target data available for this crispr