ID: 1173162587

View in Genome Browser
Species Human (GRCh38)
Location 20:40663710-40663732
Sequence TGTGAGTCCCTCGACCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173162580_1173162587 -4 Left 1173162580 20:40663691-40663713 CCACCCCTGAGATGCCTTCTGTG No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162582_1173162587 -8 Left 1173162582 20:40663695-40663717 CCCTGAGATGCCTTCTGTGAGTC No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162581_1173162587 -7 Left 1173162581 20:40663694-40663716 CCCCTGAGATGCCTTCTGTGAGT No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162583_1173162587 -9 Left 1173162583 20:40663696-40663718 CCTGAGATGCCTTCTGTGAGTCC No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162577_1173162587 28 Left 1173162577 20:40663659-40663681 CCACATTCGTTCATCTTTCAGCT No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162578_1173162587 -2 Left 1173162578 20:40663689-40663711 CCCCACCCCTGAGATGCCTTCTG No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data
1173162579_1173162587 -3 Left 1173162579 20:40663690-40663712 CCCACCCCTGAGATGCCTTCTGT No data
Right 1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173162587 Original CRISPR TGTGAGTCCCTCGACCAGGG AGG Intergenic
No off target data available for this crispr