ID: 1173163017

View in Genome Browser
Species Human (GRCh38)
Location 20:40666239-40666261
Sequence CAATAACACACGAGGCTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173163010_1173163017 27 Left 1173163010 20:40666189-40666211 CCTGTCTAAGCCTCTAAGATTCC No data
Right 1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG No data
1173163011_1173163017 17 Left 1173163011 20:40666199-40666221 CCTCTAAGATTCCTTGTCTGTAA No data
Right 1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG No data
1173163009_1173163017 28 Left 1173163009 20:40666188-40666210 CCCTGTCTAAGCCTCTAAGATTC No data
Right 1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG No data
1173163012_1173163017 6 Left 1173163012 20:40666210-40666232 CCTTGTCTGTAAACCTTTTGAGG No data
Right 1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG No data
1173163014_1173163017 -7 Left 1173163014 20:40666223-40666245 CCTTTTGAGGACCACACAATAAC No data
Right 1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173163017 Original CRISPR CAATAACACACGAGGCTCCT AGG Intergenic
No off target data available for this crispr