ID: 1173163050

View in Genome Browser
Species Human (GRCh38)
Location 20:40666399-40666421
Sequence CTGGTGGGGGACTGTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173163041_1173163050 9 Left 1173163041 20:40666367-40666389 CCCATACTGGTATCAGGGACTGT No data
Right 1173163050 20:40666399-40666421 CTGGTGGGGGACTGTGTTGTGGG No data
1173163042_1173163050 8 Left 1173163042 20:40666368-40666390 CCATACTGGTATCAGGGACTGTG No data
Right 1173163050 20:40666399-40666421 CTGGTGGGGGACTGTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173163050 Original CRISPR CTGGTGGGGGACTGTGTTGT GGG Intergenic
No off target data available for this crispr