ID: 1173163662

View in Genome Browser
Species Human (GRCh38)
Location 20:40671118-40671140
Sequence CAACTTAGACAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173163662_1173163665 -7 Left 1173163662 20:40671118-40671140 CCCAGCTCCATCTGTCTAAGTTG No data
Right 1173163665 20:40671134-40671156 TAAGTTGATGACAAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173163662 Original CRISPR CAACTTAGACAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr