ID: 1173165955 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:40687696-40687718 |
Sequence | GCGGGTGCGCGGGCGGGCAG GGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1057 | |||
Summary | {0: 1, 1: 0, 2: 8, 3: 72, 4: 976} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173165955_1173165975 | 29 | Complete | closest: 228 total_pairs: 4 max_distance: 1000 |
Left | 1173165955 | 20:40687696-40687718 | CCCCTGCCCGCCCGCGCACCCGC | 0: 1 1: 0 2: 8 3: 72 4: 976 |
Right | 1173165975 | 20:40687748-40687770 | CCCTCTCGCTCAAGTCAAACAGG | 0: 1 1: 0 2: 0 3: 5 4: 66 |
||||
1173165955_1173165962 | -10 | Complete | closest: -10 total_pairs: 9 max_distance: 1000 |
Left | 1173165955 | 20:40687696-40687718 | CCCCTGCCCGCCCGCGCACCCGC | 0: 1 1: 0 2: 8 3: 72 4: 976 |
Right | 1173165962 | 20:40687709-40687731 | GCGCACCCGCCCGTCGCCCGCGG | 0: 1 1: 0 2: 0 3: 11 4: 86 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173165955 | Original CRISPR | GCGGGTGCGCGGGCGGGCAG GGG (reversed) | Exonic | ||