ID: 1173165955

View in Genome Browser
Species Human (GRCh38)
Location 20:40687696-40687718
Sequence GCGGGTGCGCGGGCGGGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 976}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173165955_1173165975 29 Complete closest: 228
total_pairs: 4
max_distance: 1000
Left 1173165955 20:40687696-40687718 CCCCTGCCCGCCCGCGCACCCGC 0: 1
1: 0
2: 8
3: 72
4: 976
Right 1173165975 20:40687748-40687770 CCCTCTCGCTCAAGTCAAACAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1173165955_1173165962 -10 Complete closest: -10
total_pairs: 9
max_distance: 1000
Left 1173165955 20:40687696-40687718 CCCCTGCCCGCCCGCGCACCCGC 0: 1
1: 0
2: 8
3: 72
4: 976
Right 1173165962 20:40687709-40687731 GCGCACCCGCCCGTCGCCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173165955 Original CRISPR GCGGGTGCGCGGGCGGGCAG GGG (reversed) Exonic