ID: 1173166398

View in Genome Browser
Species Human (GRCh38)
Location 20:40689585-40689607
Sequence GGATGGGGGTGGGGTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173166398_1173166417 28 Left 1173166398 20:40689585-40689607 CCCTTTGCACCCCACCCCCATCC No data
Right 1173166417 20:40689636-40689658 AGCGCCGGGACAACGCCTCCTGG No data
1173166398_1173166406 -7 Left 1173166398 20:40689585-40689607 CCCTTTGCACCCCACCCCCATCC No data
Right 1173166406 20:40689601-40689623 CCCATCCCGTGTCACCCCCAAGG No data
1173166398_1173166415 13 Left 1173166398 20:40689585-40689607 CCCTTTGCACCCCACCCCCATCC No data
Right 1173166415 20:40689621-40689643 AGGAGGCTCAGAATGAGCGCCGG No data
1173166398_1173166408 -4 Left 1173166398 20:40689585-40689607 CCCTTTGCACCCCACCCCCATCC No data
Right 1173166408 20:40689604-40689626 ATCCCGTGTCACCCCCAAGGAGG No data
1173166398_1173166418 29 Left 1173166398 20:40689585-40689607 CCCTTTGCACCCCACCCCCATCC No data
Right 1173166418 20:40689637-40689659 GCGCCGGGACAACGCCTCCTGGG No data
1173166398_1173166416 14 Left 1173166398 20:40689585-40689607 CCCTTTGCACCCCACCCCCATCC No data
Right 1173166416 20:40689622-40689644 GGAGGCTCAGAATGAGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173166398 Original CRISPR GGATGGGGGTGGGGTGCAAA GGG (reversed) Intergenic
No off target data available for this crispr