ID: 1173169046

View in Genome Browser
Species Human (GRCh38)
Location 20:40707559-40707581
Sequence GCAAGGACCCCAGTGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173169038_1173169046 11 Left 1173169038 20:40707525-40707547 CCAGGGTCCAGTGTCTCATCCAT No data
Right 1173169046 20:40707559-40707581 GCAAGGACCCCAGTGGTTCAGGG No data
1173169039_1173169046 4 Left 1173169039 20:40707532-40707554 CCAGTGTCTCATCCATCACCAGC No data
Right 1173169046 20:40707559-40707581 GCAAGGACCCCAGTGGTTCAGGG No data
1173169037_1173169046 12 Left 1173169037 20:40707524-40707546 CCCAGGGTCCAGTGTCTCATCCA No data
Right 1173169046 20:40707559-40707581 GCAAGGACCCCAGTGGTTCAGGG No data
1173169041_1173169046 -8 Left 1173169041 20:40707544-40707566 CCATCACCAGCCATTGCAAGGAC No data
Right 1173169046 20:40707559-40707581 GCAAGGACCCCAGTGGTTCAGGG No data
1173169036_1173169046 13 Left 1173169036 20:40707523-40707545 CCCCAGGGTCCAGTGTCTCATCC No data
Right 1173169046 20:40707559-40707581 GCAAGGACCCCAGTGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173169046 Original CRISPR GCAAGGACCCCAGTGGTTCA GGG Intergenic
No off target data available for this crispr