ID: 1173170466

View in Genome Browser
Species Human (GRCh38)
Location 20:40719376-40719398
Sequence GACACTCATGTGACAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173170466_1173170470 -2 Left 1173170466 20:40719376-40719398 CCCACAGTTGTCACATGAGTGTC No data
Right 1173170470 20:40719397-40719419 TCTCTGGGTTCTATGCAATCTGG No data
1173170466_1173170471 8 Left 1173170466 20:40719376-40719398 CCCACAGTTGTCACATGAGTGTC No data
Right 1173170471 20:40719407-40719429 CTATGCAATCTGGCTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173170466 Original CRISPR GACACTCATGTGACAACTGT GGG (reversed) Intergenic
No off target data available for this crispr