ID: 1173171052

View in Genome Browser
Species Human (GRCh38)
Location 20:40724193-40724215
Sequence TTGAACAAACAGATGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173171052_1173171055 13 Left 1173171052 20:40724193-40724215 CCCATGTCCATCTGTTTGTTCAA No data
Right 1173171055 20:40724229-40724251 GTTTCCACTGTGATGCTGTGAGG No data
1173171052_1173171057 24 Left 1173171052 20:40724193-40724215 CCCATGTCCATCTGTTTGTTCAA No data
Right 1173171057 20:40724240-40724262 GATGCTGTGAGGTCTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173171052 Original CRISPR TTGAACAAACAGATGGACAT GGG (reversed) Intergenic
No off target data available for this crispr