ID: 1173175445

View in Genome Browser
Species Human (GRCh38)
Location 20:40761682-40761704
Sequence ATGTGAGAAGGGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173175445_1173175458 19 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175458 20:40761724-40761746 AGGGAAGAAGAGGGGGTCTCAGG No data
1173175445_1173175461 29 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175461 20:40761734-40761756 AGGGGGTCTCAGGAGCCGAGGGG No data
1173175445_1173175460 28 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175460 20:40761733-40761755 GAGGGGGTCTCAGGAGCCGAGGG No data
1173175445_1173175455 10 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175455 20:40761715-40761737 GAAATGTTAAGGGAAGAAGAGGG No data
1173175445_1173175457 12 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175457 20:40761717-40761739 AATGTTAAGGGAAGAAGAGGGGG No data
1173175445_1173175453 0 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175453 20:40761705-40761727 GAAGACTTGGGAAATGTTAAGGG No data
1173175445_1173175454 9 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175454 20:40761714-40761736 GGAAATGTTAAGGGAAGAAGAGG No data
1173175445_1173175456 11 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175456 20:40761716-40761738 AAATGTTAAGGGAAGAAGAGGGG No data
1173175445_1173175452 -1 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175452 20:40761704-40761726 TGAAGACTTGGGAAATGTTAAGG No data
1173175445_1173175459 27 Left 1173175445 20:40761682-40761704 CCCACTTCCTTCCCTTCTCACAT No data
Right 1173175459 20:40761732-40761754 AGAGGGGGTCTCAGGAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173175445 Original CRISPR ATGTGAGAAGGGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr