ID: 1173176981

View in Genome Browser
Species Human (GRCh38)
Location 20:40771896-40771918
Sequence CAAGAATAAGACAGCGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173176981_1173176983 -9 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176983 20:40771910-40771932 TTATTCTTGTCACCCAAGCCCGG No data
1173176981_1173176985 -1 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176985 20:40771918-40771940 GTCACCCAAGCCCGGGAATCTGG No data
1173176981_1173176990 13 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176990 20:40771932-40771954 GGAATCTGGCAGCCACTCTCTGG No data
1173176981_1173176984 -8 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176984 20:40771911-40771933 TATTCTTGTCACCCAAGCCCGGG No data
1173176981_1173176994 30 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG No data
1173176981_1173176991 23 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176991 20:40771942-40771964 AGCCACTCTCTGGCCAGAGATGG No data
1173176981_1173176993 29 Left 1173176981 20:40771896-40771918 CCAAGACCGCTGTCTTATTCTTG No data
Right 1173176993 20:40771948-40771970 TCTCTGGCCAGAGATGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173176981 Original CRISPR CAAGAATAAGACAGCGGTCT TGG (reversed) Intergenic
No off target data available for this crispr