ID: 1173176982

View in Genome Browser
Species Human (GRCh38)
Location 20:40771902-40771924
Sequence GGGTGACAAGAATAAGACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173176982_1173176995 27 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data
1173176982_1173176990 7 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176990 20:40771932-40771954 GGAATCTGGCAGCCACTCTCTGG No data
1173176982_1173176985 -7 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176985 20:40771918-40771940 GTCACCCAAGCCCGGGAATCTGG No data
1173176982_1173176994 24 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG No data
1173176982_1173176991 17 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176991 20:40771942-40771964 AGCCACTCTCTGGCCAGAGATGG No data
1173176982_1173176993 23 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176993 20:40771948-40771970 TCTCTGGCCAGAGATGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173176982 Original CRISPR GGGTGACAAGAATAAGACAG CGG (reversed) Intergenic
No off target data available for this crispr