ID: 1173176986

View in Genome Browser
Species Human (GRCh38)
Location 20:40771922-40771944
Sequence GCTGCCAGATTCCCGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173176986_1173176995 7 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data
1173176986_1173176997 19 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176997 20:40771964-40771986 GAACTGGGAGGCATTTCCTCAGG No data
1173176986_1173176998 27 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data
1173176986_1173176991 -3 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176991 20:40771942-40771964 AGCCACTCTCTGGCCAGAGATGG No data
1173176986_1173176993 3 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176993 20:40771948-40771970 TCTCTGGCCAGAGATGGAACTGG No data
1173176986_1173176994 4 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173176986 Original CRISPR GCTGCCAGATTCCCGGGCTT GGG (reversed) Intergenic
No off target data available for this crispr