ID: 1173176995

View in Genome Browser
Species Human (GRCh38)
Location 20:40771952-40771974
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173176987_1173176995 6 Left 1173176987 20:40771923-40771945 CCAAGCCCGGGAATCTGGCAGCC No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data
1173176982_1173176995 27 Left 1173176982 20:40771902-40771924 CCGCTGTCTTATTCTTGTCACCC No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data
1173176986_1173176995 7 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data
1173176989_1173176995 0 Left 1173176989 20:40771929-40771951 CCGGGAATCTGGCAGCCACTCTC No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data
1173176988_1173176995 1 Left 1173176988 20:40771928-40771950 CCCGGGAATCTGGCAGCCACTCT No data
Right 1173176995 20:40771952-40771974 TGGCCAGAGATGGAACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173176995 Original CRISPR TGGCCAGAGATGGAACTGGG AGG Intergenic
No off target data available for this crispr