ID: 1173176998

View in Genome Browser
Species Human (GRCh38)
Location 20:40771972-40771994
Sequence AGGCATTTCCTCAGGAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173176992_1173176998 5 Left 1173176992 20:40771944-40771966 CCACTCTCTGGCCAGAGATGGAA No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data
1173176996_1173176998 -6 Left 1173176996 20:40771955-40771977 CCAGAGATGGAACTGGGAGGCAT No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data
1173176989_1173176998 20 Left 1173176989 20:40771929-40771951 CCGGGAATCTGGCAGCCACTCTC No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data
1173176987_1173176998 26 Left 1173176987 20:40771923-40771945 CCAAGCCCGGGAATCTGGCAGCC No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data
1173176988_1173176998 21 Left 1173176988 20:40771928-40771950 CCCGGGAATCTGGCAGCCACTCT No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data
1173176986_1173176998 27 Left 1173176986 20:40771922-40771944 CCCAAGCCCGGGAATCTGGCAGC No data
Right 1173176998 20:40771972-40771994 AGGCATTTCCTCAGGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173176998 Original CRISPR AGGCATTTCCTCAGGAAATG AGG Intergenic
No off target data available for this crispr